Monitoring of chronic wasting disease using real-time quaking-induced conversion assay in Japan

Monitoring of chronic wasting disease using real-time quaking-induced conversion assay in Japan

There was no report on Power losing illness (CWD) instances in Japan to this point; nevertheless, there’s concern in regards to the geographic unfold of CWD. To make clear the CWD standing in Japan, we performed CWD monitoring utilizing real-time quaking-induced conversion (RT-QuIC) assay which might detect the low stage of CWD prions.
A complete of 690 obex samples collected from sika deer and Reeves’s muntjac in Hokkaido and Honshu was examined for CWD prions. No CWD-positive instances have been discovered, suggesting that CWD is nonexistent in Japan. Our outcomes additionally point out that RT-QuIC assay is beneficial for steady monitoring of CWD. Moreover, nucleotide sequence evaluation of the PrP gene revealed sika deer in Japan harbor CWD prone allele.

Fahr’s Syndrome Presenting With Hypocalcemia and Psychotic Options

Fahr’s illness is a uncommon genetic neurodegenerative dysfunction described as “bilateral striopallidodentate calcinosis” (BSPDC). It’s characterised by calcium deposition crossing the blood-brain barrier and calcifying totally different mind areas. Right here, we report a case of a 26-year-old Saudi younger girl, referred to as a case of epilepsy since childhood, a significant depressive dysfunction with psychotic options, and hypocalcemia associated to hypoparathyroidism.
CT mind confirmed intensive coarse calcifications involving the infra and supratentorial white matter, predominantly inside the basal ganglia, thalami, and dentate nuclei of cerebellar hemispheres. This report will talk about the difficult presentation, medical signs, and the multidisciplinary strategy to handle Fahr’s syndrome signs. In conclusion, this case emphasizes the significance of neuroimaging and metabolic workup when investigating the seizure’s etiology. The objective of therapy in Fahr’s syndrome is to handle the underlying situations.

MicroRNA-21: An Rising Participant in Bone Ailments

MicroRNAs (MiRNAs) are small endogenous non-coding RNAs that bind to the three’-untranslated area of goal genes and promote their degradation or inhibit translation, thereby regulating gene expression. MiRNAs are ubiquitous in biology and are concerned in lots of organic processes, enjoying an necessary function in a wide range of physiological and pathological processes.
MiRNA-21 (miR-21) is one in every of them. In recent times, miR-21 has acquired a whole lot of consideration from researchers as an rising participant in orthopedic ailments. MiR-21 is intently related to the incidence, growth, therapy, and prevention of orthopedic ailments via a wide range of mechanisms.
This evaluation summarizes its results on osteoblasts, osteoclasts and their relationship with osteoporosis, fracture, osteoarthritis (OA), osteonecrosis, offering a brand new mind-set for the analysis, therapy and prevention of those bone ailments.

Well being-Associated Stigma, Social Assist, Self-Efficacy, and Self-Care Actions Amongst Adults With Sickle Cell Illness in Oman

Stigma contributes to the burden of people and households affected by Sickle cell illness (SCD) and causes delay in applicable care in search of. The goal of this research is to look at the degrees and associations between stigma, social assist, self-efficacy, and self-care actions amongst grownup sufferers with SCD in Oman utilizing a cross-sectional, correlational design.
Of the 264 individuals, 56.1% (n = 148) have been males, with imply age of 30.1 years (SD 7.7). Half of the individuals have been married, and 88.3% had no different related ailments. The outcomes display that sufferers in Oman endure from health-related stigma.
Nonetheless, social assist, self-efficacy, and self-care actions have been reported to be excessive and correlated with a number of medical and demographic variables. Primarily based on the outcomes, efficient, low-cost interventions similar to psycho-educational teams, particular person counseling, or group therapies may be developed. They’ll promote perception in enhanced efficacy and improved SCD adaptation, thereby growing affected person, and supplier satisfaction.

All illness begins within the intestine’-the function of the intestinal microbiome in ankylosing spondylitis

Ankylosing spondylitis is a persistent, debilitating arthritis with a predilection for the axial skeleton. It has a robust genetic predisposition, however the exact pathogenetic mechanisms concerned in its growth haven’t but been absolutely elucidated.
This has implications each for early analysis and for efficient administration. Just lately, alterations within the intestinal microbiome have been implicated in illness pathogenesis. On this evaluation, we summarize research assessing the intestinal microbiome in AS pathogenesis, along with synthesizing the literature exploring the postulated mechanisms by which it exerts it pathogenic potential. Lastly, we evaluation research analysing manipulation of the microbiome as a possible therapeutic avenue in AS administration.

Immunoregulatory T cell epitope peptides for the therapy of allergic illness

Allergic ailments are kind 2 inflammatory reactions with an growing worldwide prevalence, making the seek for new therapeutic choices pertinent. Allergen immunotherapy is the one disease-modifying strategy for allergic rhinitis, although it may end up in systemic reactions.
Just lately, peptide immunotherapy (PIT), involving T cell epitope peptides that bind to main histocompatibility complexes, have been developed. It’s speculated that they’ll induce T helper cell kind 2 anergy, Treg cell upregulation or immune deviation.
Promising leads to cat dander, honeybee venom, Japanese cedar pollen, grass pollens, ragweed and home mud mite medical trials have proven security, efficacy and tolerability to PIT. Therefore, PIT could maintain the potential to vary the therapy algorithm for allergic rhinitis.

Immunomodulatory Capabilities of TRPM7 and its Implications in Autoimmune Ailments

Autoimamune illness is an inappropriate response to at least one’s tissues as a consequence of a break in immune tolerance and publicity to self-antigens. It typically results in structural and useful injury to organs in addition to systemic problems. Thus far, there aren’t any efficient interventions to forestall the development of autoimmune ailments.
Therefore, there’s an pressing want for brand spanking new therapy targets. TRPM7 is an enzyme-coupled, transient receptor ion channel of the subfamily M that performs a significant function in pathologic and physiologic situations. Whereas TRPM7 is constitutively activated below sure situations, it may well regulate cell migration, polarization, proliferation, and cytokine secretion.

SPG21 siRNA

20-abx934939
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-SPG21

YF-PA26169 50 ul
EUR 334
Description: Mouse polyclonal to SPG21

HEK-293T Telomerase Over-Expressing Cell Pellet

abx069991-1Pellet 1 Pellet
EUR 398
  • Shipped within 1-3 working days.

Human SPG21 Antibody

32620-05111 150 ug
EUR 261

SPG21 Antibody (HRP)

20-abx312116
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

SPG21 Antibody (FITC)

20-abx312117
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

SPG21 Antibody (Biotin)

20-abx312118
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

SPG21 cloning plasmid

CSB-CL889158HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 927
  • Sequence: atgggagagattaaagtctctcctgattataactggtttagaggtacagttccccttaaaaagattattgtggatgatgatgacagtaagatatggtcgctctatgacgcgggcccccgaagtatcaggtgtcctctcatattcctgccccctgtcagtggaactgcagatgtctt
  • Show more
Description: A cloning plasmid for the SPG21 gene.

SPG21 Polyclonal Antibody

A68002 100 µg
EUR 570.55
Description: fast delivery possible

Anti-SPG21 (2B11)

YF-MA18476 100 ug
EUR 363
Description: Mouse monoclonal to SPG21

Chymase reagent

30C-CP1129 5 units
EUR 2185
Description: Purified native Human Chymase reagent

Traut's Reagent

2330-1000
EUR 349

Traut's Reagent

2330-500
EUR 207

MTS Reagent

2808-1000
EUR 990

MTS Reagent

2808-250
EUR 365

MTT Reagent

2809-1G
EUR 180

MTT Reagent

2809-5G
EUR 544

BOP reagent

5-02141 25g Ask for price

BOP reagent

5-02142 100g Ask for price

Bluing Reagent

BRT030 30 ml
EUR 60

Bluing Reagent

BRT125 125 ml
EUR 63

Bluing Reagent

BRT3800 1 Gal.
EUR 184

Bluing Reagent

BRT500 500 ml
EUR 76

Bluing Reagent

BRT999 1000 ml
EUR 88

BOP reagent

A7015-100000 100 g
EUR 200
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

BOP reagent

A7015-25000 25 g
EUR 113
Description: A peptide coupling reagent. Can be used in the preparation of phenyl esters of amino acids which have been shown to be valuable as blocked derivatives of amino acids in the field of peptide synthesis.

Beaucage reagent

HY-100951 10mM/1mL
EUR 126

Bradford reagent

BDE641 100ml
EUR 61.01
  • Product category: Biochemicals/Biology Reagents/Protein Related

SPG21 Antibody, HRP conjugated

1-CSB-PA889158LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPG21. Recognizes SPG21 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SPG21 Antibody, FITC conjugated

1-CSB-PA889158LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPG21. Recognizes SPG21 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SPG21 Antibody, Biotin conjugated

1-CSB-PA889158LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SPG21. Recognizes SPG21 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SPG21 protein (His tag)

80R-1128 100 ug
EUR 305
Description: Purified recombinant Human SPG21 protein

Rat SPG21 shRNA Plasmid

20-abx989077
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse SPG21 shRNA Plasmid

20-abx973932
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human SPG21 shRNA Plasmid

20-abx959700
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SPG21 Recombinant Protein (Rat)

RP230783 100 ug Ask for price

SPG21 Recombinant Protein (Human)

RP029881 100 ug Ask for price

SPG21 Recombinant Protein (Mouse)

RP174977 100 ug Ask for price

Arabidopsis Thaliana Lysate

30R-AA023 150 ug
EUR 156
Description: Arabidopsis Thaliana Plant Lysate

CMV Cell Lysate

35-1867 1 mg
EUR 1835
Description: CMV enriched cell lysate

HSV1 Cell Lysate

35-1872 1 ml
EUR 394
Description: HSV1 enriched cell lysate

HSV2 Cell Lysate

35-1873 1 ml
EUR 394
Description: HSV2 enriched cell lysate

JM109-lysate Antibody

abx234439-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

BL21-lysate Antibody

abx230905-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

DH5a-lysate Antibody

abx232362-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Green Algae Lysate

PABL-1306 50 ug
EUR 164

BSA (Reagent Grade)

30-AB79 1 kg
EUR 1552
Description: Reagent Grade Bovine Serum Albumin (99% pure)

BSA (Reagent Grade)

30-AB81 200 grams
EUR 476
Description: Reagent Grade Sulphydryl Blocked BSA (99% pure)

Griess Reagent Kit

30100 1KIT
EUR 149
Description: Minimum order quantity: 1 unit of 1KIT

BODIPY-Acetylene Reagent

2594-1
EUR 207

BODIPY-Acetylene Reagent

2594-5
EUR 675

Biotin reagent (HRP)

65C-CE0202 5 mg
EUR 244
Description: HRP conjugated biotin labelling reagent

Convoy? Transfection Reagent

1110-1ml
EUR 341

Bradford Dye Reagent

0209R 100 ml
EUR 131

HAMA blocking reagent

85R-1001 1 gram
EUR 1974
Description: HAMA Blocking Reagent for use in immunoassays such as ELISA

HAMA blocking reagent

85R-1001P 1 gram
EUR 2190
Description: HAMA Blocking Reagent for use in immunoassays such as ELISA

HAMA blocking reagent

85R-1003 1 gram
EUR 1974
Description: HAMA Blocking Reagent for use in immunoassays such as Rapid Tests

HAMA blocking reagent

85R-1014 50 mg
EUR 192
Description: HAMA blocking reagent for use in assays specific for clinical false positive samples

HAMA blocking reagent

85R-1025 50 mg
EUR 192
Description: HAMA blocking reagent for use in immunoassays

HAMA blocking reagent

85R-1026 50 mg
EUR 192
Description: HAMA blocking reagent for use in immunoassays

Girard's reagent T

20-abx184099
  • EUR 203.00
  • EUR 314.00
  • 100 g
  • 500 g
  • Shipped within 1-2 weeks.

EL Transfection Reagent

20-abx098880
  • EUR 384.00
  • EUR 537.00
  • 0.75 ml
  • 1.5 ml
  • Shipped within 5-10 working days.

Mycoplasma Prevention Reagent

20-abx098886
  • EUR 425.00
  • EUR 509.00
  • 1 ml
  • 5 ml
  • Shipped within 5-10 working days.

Alcohol, Reagent (70%)

EAS500 500 ml
EUR 79

Alcohol, Reagent (70%)

EAS999 1000 ml
EUR 101

BCA Reagent, 16ML

C144-16ML 16ML
EUR 163

Biolipidure-1002-Reagent

Biolipidure-1002-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1002-Reagent is a synthetic amphoteric polymer that can be substituted for BSA in tubidimetric immunoassays. Biolipidure-1002 is an excellent blocker and also enhances assay sensitivity. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1002-Reagent

Biolipidure-1002-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1002-Reagent is a synthetic amphoteric polymer that can be substituted for BSA in tubidimetric immunoassays. Biolipidure-1002 is an excellent blocker and also enhances assay sensitivity. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-103-Reagent

Biolipidure-103-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-103-Reagent is a synthetic amphoteric polymer that can be substituted for BSA. It has been shown to enhance signals in rapid tests, western blots, and other similar immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-103-Reagent

Biolipidure-103-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-103-Reagent is a synthetic amphoteric polymer that can be substituted for BSA. It has been shown to enhance signals in rapid tests, western blots, and other similar immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1201-Reagent

Biolipidure-1201-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1201 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1201-Reagent

Biolipidure-1201-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1201 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1301-Reagent

Biolipidure-1301-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1301 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-1301-Reagent

Biolipidure-1301-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-1301 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-203-Reagent

Biolipidure-203-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-203 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-203 has been shown to enhance signal strength by improving signal-to-noise in ELISAs, EIAs, and related immunoassays. It also functions as an effective blocker and stabilizer in these assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-203-Reagent

Biolipidure-203-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-203 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-203 has been shown to enhance signal strength by improving signal-to-noise in ELISAs, EIAs, and related immunoassays. It also functions as an effective blocker and stabilizer in these assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-206-Reagent

Biolipidure-206-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-206 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-206 enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-206-Reagent

Biolipidure-206-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-206 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-206 enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-405-Reagent

Biolipidure-405-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-405 Reagent is a synthetic anionic polymer that can be used to enhance immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-405-Reagent

Biolipidure-405-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-405 Reagent is a synthetic anionic polymer that can be used to enhance immunochromatographic assays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-502-Reagent

Biolipidure-502-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-502 Reagent is a synthetic cationic polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-502-Reagent

Biolipidure-502-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-502 Reagent is a synthetic cationic polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-702-Reagent

Biolipidure-702-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-702 Reagent is a synthetic amphoteric polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-702-Reagent

Biolipidure-702-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-702 Reagent is a synthetic amphoteric polymer. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-802-Reagent

Biolipidure-802-10 10mL
EUR 196
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-802 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-802 generally enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, Rapid-test, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

Biolipidure-802-Reagent

Biolipidure-802-100 100mL
EUR 1223
  • Biolipidure enhances sensitivity and accuracy.
  • Biolipidure suppresses non-specific adsorption.
  • Biolipidure stabilizes antibodies and enzymes.
  • Biolipidure eliminates lot-to-lot variations.
  • Biolipidure does not require biohazardous handling.
Description: The Biolipidure-802 Reagent is a synthetic amphoteric polymer that can be substituted for BSA. Biolipidure-802 generally enhances signal strength, functions as an effective blocker, and stabilizes proteins and antibodies in ELISAs, EIAs, Rapid-test, and related immunoassays. Applications include: Immunoassays, Western blots, Immunohistochemistry, Turbidimetric assays, Immunochromatography, and Bead based assays. Benefits include: No lot to lot variation, No animal derived materials, Non-specific adsorption suppression, Stabilization of immobilized antibody, Stabilization of enzyme-antibody conjugate, Enzyme-substrate reaction enhancement and aggregation reaction enhancement

FcR blocking Reagent

20-abx290024
  • EUR 377.00
  • EUR 516.00
  • 200 tests
  • 400 tests
  • Shipped within 2-3 weeks.

Detection Reagent A

abx296004-120ul 120 ul
EUR 321
  • Shipped within 5-10 working days.

Mycoplasma Prevention Reagent

20-abx298005
  • EUR 203.00
  • EUR 286.00
  • 1 ml
  • 5 ml
  • Shipped within 5-10 working days.

PhosphoBlocker Blocking Reagent

AKR-103 1L
EUR 328
Description: Most commercially available Western blot blockers, such as dry milk or serum, are sufficient to block unreactive sites on the membrane. However, they are not designed to preserve phosphoprotein antigens during blotting. Our PhosphoBLOCKER Blocking Reagent provides superior blocking by maximizing signal-to-noise ratio. The PhosphoBLOCKER reagent particluarly excels with very low levels of endogenous phopsphoproteins.

PhosphoBlocker Blocking Reagent

AKR-104 4L
EUR 711
Description: Most commercially available Western blot blockers, such as dry milk or serum, are sufficient to block unreactive sites on the membrane. However, they are not designed to preserve phosphoprotein antigens during blotting. Our PhosphoBLOCKER Blocking Reagent provides superior blocking by maximizing signal-to-noise ratio. The PhosphoBLOCKER reagent particluarly excels with very low levels of endogenous phopsphoproteins.

Tri-RNA Reagent

FATRR-001 100ml
EUR 236

Tri-RNA Reagent

FATRR-002 50ml
EUR 176

Tri-RNA Reagent

FATRR-003 450ml
EUR 645

LP4K Transfection Reagent

LP4K 1.0 ml / vial
EUR 304
Description: Lipid based transfection reagent for large plasmid and multiple plasmid transfection in both adhesive and suspenstion cell types.

PureFection Transfection Reagent

LV750A-1 1 ml
EUR 359
  • Category: Lentiviral Technology

HighGene transfection reagent

RM09014 1000μl
EUR 270

TissueDigest Reagent, 20X

T101 10ml
EUR 210

ExFect2000 Transfection Reagent

T202-01 0.5 ml
EUR 227

ExFect2000 Transfection Reagent

T202-02 1 ml
EUR 316

ExFect2000 Transfection Reagent

T202-03 5 ml
EUR 1052

Dissociation Reagent, 1ML

X017-1ML 1ML
EUR 109

Dissociation Reagent, 25ML

X017-25ML 25ML
EUR 258

Dissociation Reagent, 5ML

X017-5ML 5ML
EUR 122

Dissociation Reagent, 1ML

X058-1ML 1ML
EUR 73

Dissociation Reagent, 5ML

X058-5ML 5ML
EUR 109

DTT (Cleland's reagent)

DB0058 5g
EUR 84.8
  • Product category: Electrophoresis Related/Reducing Agents

DTNB (Ellman's Reagent)

DB0113 5g
EUR 97.85
  • Product category: Biochemicals/Indicators/Stains/Peptide/Protein Related

Ethyl acetate Reagent

EC4600 1L
EUR 79
  • Product category: Biochemicals/Solvents

n-Heptane Reagent

HC5400 1L
EUR 79
  • Product category: Biochemicals/Solvents

Human SPG21 Antibody (Biotin Conjugate)

32620-05121 150 ug
EUR 369

Mouse Maspardin, Spg21 ELISA KIT

ELI-18732m 96 Tests
EUR 865

Human Maspardin, SPG21 ELISA KIT

ELI-19130h 96 Tests
EUR 824

Bovine Maspardin, SPG21 ELISA KIT

ELI-52857b 96 Tests
EUR 928

SPG21 Polyclonal Antibody, HRP Conjugated

A68003 100 µg
EUR 570.55
Description: reagents widely cited

SPG21 Polyclonal Antibody, FITC Conjugated

A68004 100 µg
EUR 570.55
Description: Ask the seller for details

SPG21 Polyclonal Antibody, Biotin Conjugated

A68005 100 µg
EUR 570.55
Description: The best epigenetics products

Spg21 ORF Vector (Rat) (pORF)

ORF076929 1.0 ug DNA
EUR 506

SPG21 ORF Vector (Human) (pORF)

ORF009961 1.0 ug DNA
EUR 95

Spg21 ORF Vector (Mouse) (pORF)

ORF058327 1.0 ug DNA
EUR 506

Human Brain Tissue Lysate

30R-AB017 150 ug
EUR 273
Description: Fresh tissue lysate isolated from human brain

Chicken Liver Tissue Lysate

30R-AC011 150 ug
EUR 192
Description: Freshly prepared tissue lysate isolated from liver of normal chicken

Human Cerebellum Tissue Lysate

30R-AC058 150 ug
EUR 290
Description: Freshly prepared tissue lysate isolated from cerebellum of human brain

Human Hippocampus Tissue Lysate

30R-AH 150 ug
EUR 273
Description: Isolated Human Hippocampus Tissue Lysate

Human Heart Tissue Lysate

30R-AH049 150 ug
EUR 534
Description: Fresh tissue lysate isolated from human heart

Jurkat cell Lysate (untreated)

2401-100
EUR 185

Human Kidney Tissue Lysate

30R-AK003 150 ug
EUR 219
Description: Fresh tissue lysate isolated from human kidney

Rabbit Liver Tissue Lysate

30R-AL003 150 ug
EUR 252
Description: Fresh tissue lysate prepared from rabbit liver

Human Lung Tissue Lysate

30R-AL006 150 ug
EUR 219
Description: Fresh tissue lysate isolated from human lung

Human Midbrain Tissue Lysate

30R-AM011 150 ug
EUR 257
Description: Fresh tissue lysate isolated from the midbrain of human brain

Human Pancreas Tissue Lysate

30R-AP030 150 ug
EUR 219
Description: Fresh tissue lysate isolated from human pancreas

Human Prostate Tissue Lysate

30R-AP031 150 ug
EUR 219
Description: Fresh tissue lysate prepared from normal human prostate

Human Pons Tissue Lysate

30R-AP033 150 ug
EUR 235
Description: Fresh tissue lysate isolated from the pons of human brain

Human Posterior Cortex Lysate

30R-AP034 150 ug
EUR 235
Description: Fresh tissue lysate isolated from the posterior cortex of human brain

Rat Retina Tissue Lysate

30R-AR005 150 ug
EUR 267
Description: Fresh tissue lysate prepared from the retina of rat eye

Human Striatum Tissue Lysate

30R-AS030 150 ug
EUR 327
Description: Fresh tissue lysate isolated from the striatum of human brain

Human Stomach Tissue Lysate

30R-AS039 150 ug
EUR 219
Description: Fresh tissue lysate isolated from human stomach

Human Thalamus Tissue Lysate

30R-AT053 150 ug
EUR 235
Description: Fresh tissue lysate isolated from the thalamus of human brain

JNK Activated Cell Lysate

7032-1
EUR 316

Akt Activated Cell Lysate

7036-1
EUR 316

BL21(DE3)-lysate Antibody

abx230903-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

BL21(plysS) -lysate Antibody

abx230904-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Human Lung Tumor lysate

HTL-1321 1 mg
EUR 773

Human Brain Tumor lysate

HTL-1322 1 mg
EUR 773

Human Breast Tumor lysate

HTL-1323 1 mg
EUR 773

Human Kidney Tumor lysate

HTL-1324 1 mg
EUR 773

Human Bladder Tumor lysate

HTL-1325 1 mg
EUR 773

Human Cervix Tumor lysate

HTL-1326 100ug
EUR 286

Human Duodenum Tumor lysate

HTL-1328 1 mg
EUR 895

Human Esophagus tumor lysate

HTL-1329 1 mg
EUR 773

Human Liver Tumor lysate

HTL-1330 1 mg
EUR 773

Human Lymphoma Tumor lysate

HTL-1331 1 mg
EUR 773

Human Ovary Tumor lysate

HTL-1333 1 mg
EUR 773

Human Pancreas Tumor lysate

HTL-1334 1 mg
EUR 773

Human Prostate Tumor lysate

HTL-1335 1 mg
EUR 773

Human Rectum Tumor lysate

HTL-1336 1 mg
EUR 773

Human Skin Tumor lysate

HTL-1337 1 mg
EUR 773

Human Spleen Tumor lysate

HTL-1339 1 mg
EUR 773

Human Stomach Tumor lysate

HTL-1340 1 mg
EUR 773

Human Testis Tumor lysate

HTL-1381 1 mg
EUR 773

Human Thymoma Tumor lysate

HTL-1382 1 mg
EUR 773
Nonetheless, a rising physique of proof highlights the crucial function of TRPM7 in autoimmune ailments, together with rheumatoid arthritis, a number of sclerosis, and diabetes. Herein we current; a) a evaluation of the channel kinase properties of TRPM7 and its pharmacological properties, b) talk about the function of TRPM7 in immune cells (neutrophils, macrophages, lymphocytes, and mast cells) and its upstream immunoreactive substances, and c) spotlight TRPM7 as a possible therapeutic goal for autoimmune ailments.

Leave a Reply

Your email address will not be published. Required fields are marked *