Characterizing the Retinal Phenotype of the Thy1-h[A30P]α-syn Mouse Model of Parkinson's Disease

Characterizing the Retinal Phenotype of the Thy1-h[A30P]α-syn Mouse Model of Parkinson’s Disease

Regardless of many years of analysis, disease-modifying therapies of Parkinson’s illness (PD), the second commonest neurodegenerative illness worldwide, stay out of attain. One of many causes for this therapy hole is the unfinished understanding of how misfolded alpha-synuclein (α-syn) contributes to PD pathology.
The retina, as an integral a part of the central nervous system, recapitulates the PD illness processes which are usually seen within the mind, and retinal manifestations have emerged as prodromal signs of the illness. The timeline of PD manifestations within the visible system, nevertheless, just isn’t totally elucidated and the underlying mechanisms are obscure.
This highlights the necessity for brand spanking new research investigating retinal pathology, with the intention to propel its use as PD biomarker, and to develop validated analysis fashions to research PD pathogenesis. The current examine pioneers in characterizing the retina of the Thy1-h[A30P]α-syn PD transgenic mouse mannequin.
We show widespread α-syn accumulation within the interior retina of those mice, of which a proportion is phosphorylated but not aggregated. This α-syn expression coincides with interior retinal atrophy attributable to postsynaptic degeneration. We additionally reveal irregular retinal electrophysiological responses.
Absence of selective lack of melanopsin retinal ganglion cells or dopaminergic amacrine cells and irritation signifies that the retinal manifestations in these transgenic mice diverge from their mind phenotype, and questions the precise mobile or molecular alterations that underlie retinal pathology on this PD mouse mannequin.
Nonetheless, the noticed α-syn accumulation, synapse loss and practical deficits recommend that the Thy1-h[A30P]α-syn retina mimics a few of the options of prodromal PD, and thus could present a window to watch and examine the preclinical/prodromal levels of PD, PD-associated retinal illness processes, in addition to assist in retinal biomarker discovery and validation.
Characterizing the Retinal Phenotype of the Thy1-h[A30P]α-syn Mouse Model of Parkinson's Disease

Illness sort detection in lung and colon most cancers photographs utilizing the complement strategy of inefficient units

Lung and colon cancers are lethal illnesses that may develop concurrently in organs and adversely have an effect on human life in some particular circumstances. Though the frequency of simultaneous prevalence of those two kinds of most cancers is unlikely, there’s a excessive likelihood of metastasis between the 2 organs if not recognized early.
Historically, specialists must undergo a prolonged and sophisticated course of to look at histopathological photographs and diagnose most cancers circumstances; but, it’s now doable to realize this course of sooner with the obtainable technological prospects. On this examine, synthetic intelligence-supported mannequin and optimization strategies had been used to understand the classification of lung and colon cancers’ histopathological photographs.
The used dataset has 5 courses of histopathological photographs consisting of two colon most cancers courses and three lung most cancers courses. Within the proposed strategy, the picture courses had been skilled from scratch with the DarkNet-19 mannequin, which is without doubt one of the deep studying fashions. Within the function set extracted from the DarkNet-19 mannequin, choice of the inefficient options was carried out by utilizing Equilibrium and Manta Ray Foraging optimization algorithms.
Then, the set containing the inefficient options was distinguished from the remainder of the set options, creating an environment friendly function set (complementary rule insets). The environment friendly options obtained by the 2 used optimization algorithms had been mixed and categorized with the Help Vector Machine (SVM) methodology.
The general accuracy price obtained within the classification course of was 99.69%. Based mostly on the outcomes of this examine, it has been noticed that utilizing the complementary methodology along with some optimization strategies improved the classification efficiency of the dataset.

Matrix tablets primarily based on a novel poly (magnesium acrylate) hydrogel for the therapy of inflammatory bowel illnesses

The target of this work was to judge the potential use of a brand new polymer (PAMgA) within the growth sustained launch matrix tablets for the therapy of bowel inflammatory illnesses. For this objective, budesonide, a extremely lipophilic compound, was used as mannequin drug.
Tablets with two reticulation grades of PAMgA (PAMgA 5 and 40) and with 9 mg of budesonide had been developed and characterised. All of the research had been carried out utilizing biorelevant media (FaSSGF and FaSSIF). Swelling and erosion of PAMgA tablets was influenced by the reticulation grade of the polymer and the biorelevant media assayed, being water uptake greater for PAMgA 40 tablets in intestinal fluid, whereas PAMgA 5 confirmed extra intense erosion on this biorelevant medium.
Budesonide was launched slowly from PAMgA tablets, each in gastric and intestinal setting, following Tremendous case II transport kinetics (relaxation-controlled supply), with a lag time of round 1-2 hours. When the dissolution medium was modified sequentially all through the trial, 75% of the budesonide dose was launched in a sustained method between four and 20 hours of testing from PAMgA tablets, exhibiting a extra managed budesonide launch than Entocort® and Budenofalk® (commercially obtainable sustained launch formulations of budesonide). In conclusion, PAMgA polymer permits controlling the discharge of extremely lipophilic medication as budesonide, being an helpful excipient for the event of sustained launch matrix tablets.

Latest progress on Tourette syndrome

Tic issues and Tourette syndrome are the commonest motion issues in kids and are characterised by actions or vocalizations. Clinically, Tourette syndrome is incessantly related to comorbid psychiatric signs. Though dysfunction of cortical-striatal-thalamic-cortical circuits with aberrant neurotransmitter perform has been thought-about the proximate explanation for tics, the mechanism underlying this affiliation is unclear.
Characterizing the Retinal Phenotype of the Thy1-h[A30P]α-syn Mouse Model of Parkinson's Disease
Lately, many research have been performed to elucidate the epidemiology, medical course, comorbid signs, and pathophysiology of tic issues by utilizing laboratory research, neuroimaging, electrophysiological testing, environmental publicity, and genetic testing.

Human Ribosome matuion protein SBDS(SBDS) ELISA kit

E01R0426-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Ribosome matuion protein SBDS(SBDS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosome matuion protein SBDS(SBDS) ELISA kit

E01R0426-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Ribosome matuion protein SBDS(SBDS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosome matuion protein SBDS(SBDS) ELISA kit

E01R0426-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Ribosome matuion protein SBDS(SBDS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Ribosome maturation protein SBDS, SBDS ELISA KIT

ELI-53028h 96 Tests
EUR 824

Human Ribosome maturation protein SBDS (SBDS) ELISA Kit

abx383035-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

SBDS Recombinant Protein (Human)

RP027628 100 ug Ask for price

Ribosome maturation protein SBDS (SBDS) Antibody (HRP)

20-abx337516
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosome maturation protein SBDS (SBDS) Antibody (FITC)

20-abx337517
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Ribosome maturation protein SBDS (SBDS) Antibody (Biotin)

20-abx337518
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Sbds/ Rat Sbds ELISA Kit

ELI-18892r 96 Tests
EUR 886

Rat Ribosome matuion protein SBDS(SBDS) ELISA kit

E02R0426-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Ribosome matuion protein SBDS(SBDS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ribosome matuion protein SBDS(SBDS) ELISA kit

E02R0426-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Ribosome matuion protein SBDS(SBDS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ribosome matuion protein SBDS(SBDS) ELISA kit

E02R0426-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Ribosome matuion protein SBDS(SBDS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ribosome matuion protein SBDS(SBDS) ELISA kit

E03R0426-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Ribosome matuion protein SBDS(SBDS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ribosome matuion protein SBDS(SBDS) ELISA kit

E03R0426-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Ribosome matuion protein SBDS(SBDS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ribosome matuion protein SBDS(SBDS) ELISA kit

E03R0426-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Ribosome matuion protein SBDS(SBDS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ribosome matuion protein SBDS(SBDS) ELISA kit

E04R0426-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Ribosome matuion protein SBDS(SBDS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ribosome matuion protein SBDS(SBDS) ELISA kit

E04R0426-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Ribosome matuion protein SBDS(SBDS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Ribosome matuion protein SBDS(SBDS) ELISA kit

E04R0426-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Ribosome matuion protein SBDS(SBDS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ribosome matuion protein SBDS(SBDS) ELISA kit

E06R0426-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Ribosome matuion protein SBDS(SBDS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ribosome matuion protein SBDS(SBDS) ELISA kit

E06R0426-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Ribosome matuion protein SBDS(SBDS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Ribosome matuion protein SBDS(SBDS) ELISA kit

E06R0426-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Ribosome matuion protein SBDS(SBDS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ribosome matuion protein SBDS(SBDS) ELISA kit

E07R0426-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Ribosome matuion protein SBDS(SBDS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ribosome matuion protein SBDS(SBDS) ELISA kit

E07R0426-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Ribosome matuion protein SBDS(SBDS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Ribosome matuion protein SBDS(SBDS) ELISA kit

E07R0426-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Ribosome matuion protein SBDS(SBDS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ribosome matuion protein SBDS(SBDS) ELISA kit

E08R0426-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Ribosome matuion protein SBDS(SBDS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ribosome matuion protein SBDS(SBDS) ELISA kit

E08R0426-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Ribosome matuion protein SBDS(SBDS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Ribosome matuion protein SBDS(SBDS) ELISA kit

E08R0426-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Ribosome matuion protein SBDS(SBDS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ribosome matuion protein SBDS(SBDS) ELISA kit

E09R0426-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Ribosome matuion protein SBDS(SBDS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ribosome matuion protein SBDS(SBDS) ELISA kit

E09R0426-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Ribosome matuion protein SBDS(SBDS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Ribosome matuion protein SBDS(SBDS) ELISA kit

E09R0426-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Ribosome matuion protein SBDS(SBDS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Bovine Ribosome maturation protein SBDS, SBDS ELISA KIT

ELI-53193b 96 Tests
EUR 928

Mouse Ribosome maturation protein SBDS, Sbds ELISA KIT

ELI-29543m 96 Tests
EUR 865

Chicken Ribosome maturation protein SBDS, SBDS ELISA KIT

ELI-39255c 96 Tests
EUR 928

Mouse Ribosome maturation protein SBDS (SBDS) ELISA Kit

abx390561-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Rat Ribosome maturation protein SBDS (SBDS) ELISA Kit

abx391965-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

SBDS siRNA

20-abx904779
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SBDS antibody

38702-100ul 100ul
EUR 252

SBDS Antibody

43044-100ul 100ul
EUR 252

SBDS antibody

10R-7935 50 ul
EUR 208
Description: Mouse monoclonal SBDS antibody

SBDS antibody

70R-20094 50 ul
EUR 435
Description: Rabbit polyclonal SBDS antibody

SBDS antibody

70R-1180 100 ug
EUR 377
Description: Rabbit polyclonal SBDS antibody raised against the N terminal of SBDS

SBDS antibody

70R-1181 100 ug
EUR 377
Description: Rabbit polyclonal SBDS antibody raised against the C terminal of SBDS

SBDS siRNA

20-abx932499
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SBDS siRNA

20-abx932500
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SBDS Antibody

1-CSB-PA897481LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SBDS. Recognizes SBDS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

SBDS Antibody

1-CSB-PA020725GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SBDS. Recognizes SBDS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Guinea pig Ribosome matuion protein SBDS(SBDS) ELISA kit

E05R0426-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Ribosome matuion protein SBDS(SBDS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Ribosome matuion protein SBDS(SBDS) ELISA kit

E05R0426-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Ribosome matuion protein SBDS(SBDS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Ribosome matuion protein SBDS(SBDS) ELISA kit

E05R0426-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Ribosome matuion protein SBDS(SBDS) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

SBDS protein (His tag)

80R-1523 100 ug
EUR 305
Description: Purified recombinant Human SBDS protein

SBDS Recombinant Protein (Rat)

RP227516 100 ug Ask for price

SBDS Recombinant Protein (Mouse)

RP170060 100 ug Ask for price

SBDS ELISA KIT|Human

EF002728 96 Tests
EUR 689

Human SBDS shRNA Plasmid

20-abx959539
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SBDS Conjugated Antibody

C38702 100ul
EUR 397

SBDS Conjugated Antibody

C43044 100ul
EUR 397

anti- SBDS antibody

FNab07617 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:100
  • IF: 1:50 - 1:200
  • Immunogen: Shwachman-Bodian-Diamond syndrome
  • Uniprot ID: Q9Y3A5
  • Gene ID: 51119
  • Research Area: Metabolism
Description: Antibody raised against SBDS

SBDS Polyclonal Antibody

A70351 100 ?g
EUR 628.55
Description: The best epigenetics products

SBDS Rabbit pAb

A5876-100ul 100 ul
EUR 308

SBDS Rabbit pAb

A5876-200ul 200 ul
EUR 459

SBDS Rabbit pAb

A5876-20ul 20 ul
EUR 183

SBDS Rabbit pAb

A5876-50ul 50 ul
EUR 223

SBDS Blocking Peptide

33R-5342 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SBDS antibody, catalog no. 70R-1180

SBDS Blocking Peptide

33R-2237 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SBDS antibody, catalog no. 70R-1181

SBDS cloning plasmid

CSB-CL897481HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 753
  • Sequence: atgtcgatcttcacccccaccaaccagatccgcctaaccaatgtggccgtggtacggatgaagcgtgccgggaagcgcttcgaaatcgcctgctacaaaaacaaggtcgtcggctggcggagcggcgtggaaaaagacctcgatgaagttctgcagacccactcagtgtttgtaaa
  • Show more
Description: A cloning plasmid for the SBDS gene.

Anti-SBDS antibody

PAab07617 100 ug
EUR 386

Anti-SBDS antibody

STJ28149 100 µl
EUR 277
Description: This gene encodes a member of a highly conserved protein family that exists from archaea to vertebrates and plants. The encoded protein may function in RNA metabolism. Mutations within this gene are associated with Shwachman-Bodian-Diamond syndrome. An alternative transcript has been described, but its biological nature has not been determined. This gene has a closely linked pseudogene that is distally located.

SBDS ORF Vector (Human) (pORF)

ORF009210 1.0 ug DNA
EUR 95

SBDS Protein Vector (Human) (pPB-C-His)

PV036837 500 ng
EUR 329

SBDS Protein Vector (Human) (pPB-N-His)

PV036838 500 ng
EUR 329

SBDS Protein Vector (Human) (pPM-C-HA)

PV036839 500 ng
EUR 329

SBDS Protein Vector (Human) (pPM-C-His)

PV036840 500 ng
EUR 329

Recombinant Human SBDS Protein, His, E.coli-1mg

QP13425-1mg 1mg
EUR 2757

Recombinant Human SBDS Protein, His, E.coli-20ug

QP13425-20ug 20ug
EUR 201

Recombinant Human SBDS Protein, His, E.coli-5ug

QP13425-5ug 5ug
EUR 155

Mouse SBDS shRNA Plasmid

20-abx975755
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat SBDS shRNA Plasmid

20-abx988330
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SBDS Antibody, HRP conjugated

1-CSB-PA897481LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SBDS. Recognizes SBDS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SBDS Antibody, FITC conjugated

1-CSB-PA897481LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SBDS. Recognizes SBDS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SBDS Antibody, Biotin conjugated

1-CSB-PA897481LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SBDS. Recognizes SBDS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SBDS Shwachman-Bodian-Diamond Syndrome Human Recombinant Protein

PROTQ9Y3A5 Regular: 20ug
EUR 317
Description: SBDS produced in E.Coli is a single, non-glycosylated polypeptide chain containing 270 amino acids (1-250a.a.) and having a molecular mass of 30.9kDa.;SBDS is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Human SBDS Protein (Ser 2-Glu 250) [His]

VAng-2680Lsx-100g 100 µg
EUR 594
Description: Human SBDS protein, His tag, was expressed in E. coli. (Uniprot ID: AAH65700)

Human SBDS Protein (Ser 2-Glu 250) [His]

VAng-2680Lsx-1mg 1 mg
EUR 2745
Description: Human SBDS protein, His tag, was expressed in E. coli. (Uniprot ID: AAH65700)

SBDS sgRNA CRISPR Lentivector set (Human)

K2091201 3 x 1.0 ug
EUR 339

SBDS Protein Vector (Rat) (pPB-C-His)

PV303358 500 ng
EUR 603

SBDS Protein Vector (Rat) (pPB-N-His)

PV303359 500 ng
EUR 603

SBDS Protein Vector (Rat) (pPM-C-HA)

PV303360 500 ng
EUR 603

SBDS Protein Vector (Rat) (pPM-C-His)

PV303361 500 ng
EUR 603

SBDS Protein Vector (Mouse) (pPB-C-His)

PV226750 500 ng
EUR 603

SBDS Protein Vector (Mouse) (pPB-N-His)

PV226751 500 ng
EUR 603

SBDS Protein Vector (Mouse) (pPM-C-HA)

PV226752 500 ng
EUR 603

SBDS Protein Vector (Mouse) (pPM-C-His)

PV226753 500 ng
EUR 603

SBDS Polyclonal Antibody, HRP Conjugated

A70352 100 ?g
EUR 628.55
Description: kits suitable for this type of research

SBDS Polyclonal Antibody, FITC Conjugated

A70353 100 ?g
EUR 628.55
Description: fast delivery possible

SBDS Polyclonal Antibody, Biotin Conjugated

A70354 100 ?g
EUR 628.55
Description: reagents widely cited

Sbds ORF Vector (Mouse) (pORF)

ORF056688 1.0 ug DNA
EUR 506

Sbds ORF Vector (Rat) (pORF)

ORF075840 1.0 ug DNA
EUR 506

SBDS sgRNA CRISPR Lentivector (Human) (Target 1)

K2091202 1.0 ug DNA
EUR 154

SBDS sgRNA CRISPR Lentivector (Human) (Target 2)

K2091203 1.0 ug DNA
EUR 154

SBDS sgRNA CRISPR Lentivector (Human) (Target 3)

K2091204 1.0 ug DNA
EUR 154

Shwachman-Bodian-Diamond Syndrome (SBDS) Antibody

20-abx115534
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Shwachman-Bodian-Diamond Syndrome (SBDS) Antibody

20-abx137382
  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Sbds sgRNA CRISPR Lentivector set (Mouse)

K4626001 3 x 1.0 ug
EUR 339

Sbds sgRNA CRISPR Lentivector set (Rat)

K7401701 3 x 1.0 ug
EUR 339

Sbds sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4626002 1.0 ug DNA
EUR 154

Sbds sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4626003 1.0 ug DNA
EUR 154

Sbds sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4626004 1.0 ug DNA
EUR 154

Sbds sgRNA CRISPR Lentivector (Rat) (Target 1)

K7401702 1.0 ug DNA
EUR 154

Sbds sgRNA CRISPR Lentivector (Rat) (Target 2)

K7401703 1.0 ug DNA
EUR 154

Sbds sgRNA CRISPR Lentivector (Rat) (Target 3)

K7401704 1.0 ug DNA
EUR 154

Sbds 3'UTR GFP Stable Cell Line

TU168362 1.0 ml Ask for price

SBDS 3'UTR Luciferase Stable Cell Line

TU022612 1.0 ml
EUR 1521

Sbds 3'UTR Luciferase Stable Cell Line

TU118362 1.0 ml Ask for price

SBDS 3'UTR GFP Stable Cell Line

TU072612 1.0 ml
EUR 1521

Sbds 3'UTR Luciferase Stable Cell Line

TU219932 1.0 ml Ask for price

Sbds 3'UTR GFP Stable Cell Line

TU269932 1.0 ml Ask for price

SBDS sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K2091205 3 x 1.0 ug
EUR 376

SBDS Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV694543 1.0 ug DNA
EUR 514

SBDS Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV694547 1.0 ug DNA
EUR 514

SBDS Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV694548 1.0 ug DNA
EUR 514

SBDS sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K2091206 1.0 ug DNA
EUR 167

SBDS sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K2091207 1.0 ug DNA
EUR 167

SBDS sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K2091208 1.0 ug DNA
EUR 167

Sbds sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4626005 3 x 1.0 ug
EUR 376

Sbds sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7401705 3 x 1.0 ug
EUR 376

Sbds sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4626006 1.0 ug DNA
EUR 167

Sbds sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4626007 1.0 ug DNA
EUR 167

Sbds sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4626008 1.0 ug DNA
EUR 167

SBDS Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV694544 1.0 ug DNA
EUR 514

SBDS Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV694545 1.0 ug DNA
EUR 572

SBDS Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV694546 1.0 ug DNA
EUR 572

Sbds sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7401706 1.0 ug DNA
EUR 167

Sbds sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7401707 1.0 ug DNA
EUR 167

Sbds sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7401708 1.0 ug DNA
EUR 167

Human Protein Z (PROZ) Protein

20-abx654876
  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Protein S (PROS) Protein

abx670077-50ug 50 ug
EUR 300
  • Shipped within 1 week.

Human Prion Protein (PRNP) Protein

20-abx068667
  • EUR 690.00
  • EUR 286.00
  • EUR 2110.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Protein C (PROC) Protein

20-abx068731
  • EUR 759.00
  • EUR 300.00
  • EUR 2388.00
  • EUR 913.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Protein S (PROS) Protein

20-abx068765
  • EUR 495.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 578.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Protein S (PROS) Protein

20-abx068766
  • EUR 495.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 578.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Human Kell Protein (KEL) Protein

20-abx168735
  • EUR 662.00
  • EUR 272.00
  • EUR 2040.00
  • EUR 787.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Translocator Protein (TSPO) Protein

20-abx165906
  • EUR 676.00
  • EUR 272.00
  • EUR 2068.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

p53 Protein Human Recombinant Protein

PROTP04637-1 Regular: 5ug
EUR 479
Description: p53 Human Recombinant full length produced in E.Coli is a non-glycosylated, polypeptide chain having a total Mw of 81kDa. p53 Human Recombinant is fused to GST tag and purified by proprietary chromatographic techniques.

PHF11 Protein Human Recombinant Protein

PROTQ9UIL8 Regular: 20ug
EUR 317
Description: PHF11 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 351 amino acids (1-331 a.a.) and having a molecular mass of 39.7kDa.;PHF11 is fused to a 20 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

BAD Protein Human Recombinant Protein

PROTQ92934 Regular: 5ug
EUR 479
Description: Bcl2 antagonist of cell death (BAD) Human Recombinant full length protein expressed in E.coli, shows a 51 kDa band on SDS-PAGE(Icluding GST tag). ;The BAD protein is purified by proprietary chromatographic techniques.

Human ORM2 Protein

20-abx690001
  • EUR 982.00
  • EUR 662.00
  • 100 ug
  • 50 ug
  • Shipped within 1-2 working days.

Human ORM2 Protein

20-abx600022
  • EUR 481.00
  • EUR 244.00
  • EUR 690.00
  • EUR 1038.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 500 ug
  • 50 ug
  • Shipped within 1-2 working days.

Human HSD17B10 Protein

20-abx600029
  • EUR 516.00
  • EUR 244.00
  • EUR 746.00
  • EUR 1135.00
  • EUR 370.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 500 ug
  • 50 ug
  • Shipped within 2 months.

Human HSD17B10 Protein

20-abx600030
  • EUR 2708.00
  • EUR 1581.00
  • EUR 1762.00
  • EUR 1205.00
  • 1 mg
  • 200 ug
  • 500 ug
  • 50 ug
  • Shipped within 3 months.

Human KISS1 Protein

20-abx650840
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human EOMES Protein

20-abx650843
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human SH3BP2 Protein

20-abx650844
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human MAGEA1 Protein

20-abx650851
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human APBB1 Protein

20-abx650853
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human DTNBP1 Protein

20-abx650859
  • EUR 411.00
  • EUR 217.00
  • EUR 1052.00
  • EUR 467.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human FVT1 Protein

20-abx650862
  • EUR 300.00
  • EUR 203.00
  • EUR 746.00
  • EUR 342.00
  • EUR 258.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human NRCAM Protein

20-abx650867
  • EUR 453.00
  • EUR 230.00
  • EUR 1233.00
  • EUR 523.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human RRBP1 Protein

20-abx650869
  • EUR 759.00
  • EUR 300.00
  • EUR 2388.00
  • EUR 913.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human SYNPO Protein

20-abx650873
  • EUR 773.00
  • EUR 300.00
  • EUR 2444.00
  • EUR 926.00
  • EUR 551.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human DCTN2 Protein

20-abx650874
  • EUR 398.00
  • EUR 217.00
  • EUR 1010.00
  • EUR 453.00
  • EUR 286.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human CAPN5 Protein

20-abx650875
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human PTPN14 Protein

20-abx650880
  • EUR 495.00
  • EUR 244.00
  • EUR 1414.00
  • EUR 578.00
  • EUR 356.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human ABCA7 Protein

20-abx650882
  • EUR 815.00
  • EUR 314.00
  • EUR 2611.00
  • EUR 982.00
  • EUR 578.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human COASY Protein

20-abx650883
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human PPAP2B Protein

20-abx650885
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human SLC22A11 Protein

20-abx650889
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human CTP Protein

20-abx650890
  • EUR 523.00
  • EUR 244.00
  • EUR 1497.00
  • EUR 606.00
  • EUR 384.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human SLC25A39 Protein

20-abx650891
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human OGC Protein

20-abx650892
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Agc1 Protein

20-abx650893
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human SLC25A13 Protein

20-abx650894
  • EUR 537.00
  • EUR 244.00
  • EUR 1525.00
  • EUR 620.00
  • EUR 398.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human ERCC6 Protein

20-abx650902
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human XPB Protein

20-abx650903
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human PEX19 Protein

20-abx650904
  • EUR 411.00
  • EUR 217.00
  • EUR 1052.00
  • EUR 467.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human PFDN2 Protein

20-abx650906
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human EIF3M Protein

20-abx650910
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human EEF1a2 Protein

20-abx650911
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human TIF1b Protein

20-abx650913
  • EUR 411.00
  • EUR 217.00
  • EUR 1052.00
  • EUR 467.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human MED6 Protein

20-abx650925
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human MED8 Protein

20-abx650926
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human NCOR1 Protein

20-abx650927
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human SF3B1 Protein

20-abx650930
  • EUR 411.00
  • EUR 217.00
  • EUR 1052.00
  • EUR 467.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human XYLT1 Protein

20-abx650932
  • EUR 815.00
  • EUR 314.00
  • EUR 2611.00
  • EUR 982.00
  • EUR 578.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human XPO4 Protein

20-abx650937
  • EUR 815.00
  • EUR 314.00
  • EUR 2611.00
  • EUR 982.00
  • EUR 578.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human BEST4 Protein

20-abx650939
  • EUR 759.00
  • EUR 300.00
  • EUR 2388.00
  • EUR 913.00
  • EUR 537.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human BEST2 Protein

20-abx650940
  • EUR 815.00
  • EUR 314.00
  • EUR 2611.00
  • EUR 982.00
  • EUR 578.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human CACNa1S Protein

20-abx650941
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human CAPN7 Protein

20-abx650943
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human CAPN11 Protein

20-abx650944
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human CEP55 Protein

20-abx650950
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human CETN3 Protein

20-abx650953
  • EUR 411.00
  • EUR 217.00
  • EUR 1052.00
  • EUR 467.00
  • EUR 300.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human FBLN7 Protein

20-abx650955
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human FBXO3 Protein

20-abx650956
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human FLRT1 Protein

20-abx650959
  • EUR 495.00
  • EUR 244.00
  • EUR 1372.00
  • EUR 565.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human GRB14 Protein

20-abx650967
  • EUR 565.00
  • EUR 258.00
  • EUR 1636.00
  • EUR 662.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human HIPK4 Protein

20-abx650971
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human HIPK3 Protein

20-abx650972
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human HMHA1 Protein

20-abx650973
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human HPCAL4 Protein

20-abx650974
  • EUR 565.00
  • EUR 258.00
  • EUR 1636.00
  • EUR 662.00
  • EUR 411.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.
As well as, many researchers have targeted on therapy for tics, together with behavioral remedy, pharmacological therapy, and surgical therapy. Right here, we offer an summary of latest progress on Tourette syndrome.

Leave a Reply

Your email address will not be published. Required fields are marked *